Temitope Kolawole

346 posts

Temitope Kolawole banner
Temitope Kolawole

Temitope Kolawole

@Deepthinke

Msc Candidate at Institute of Genomics. Bioinformatician, Creative writer, Seeker of personal freedom and possibilitarian.

Osun, Nigeria Entrou em Haziran 2020
519 Seguindo238 Seguidores
Temitope Kolawole retweetou
Michael Strong
Michael Strong@flowidealism·
A tiny country produced half of the mathematical geniuses of the 20th century. To an unrecognized extent, it was coffee shop culture. Hungary gave us von Neumann, Erdős, Teller, Szilard, and many others. Scientists called them "the Martians" because their brilliance seemed otherworldly. It was in the Budapest coffee shops where mathematicians gathered. Where problems were discussed openly. Where young people could observe and join. Where intellectual passion was the social currency. The Minta school created a culture of mathematical problem-solving. Students competed in mathematics journals. The brightest minds mentored the next generation in cafes, not classrooms. We look at exceptional achievement and assume exceptional genes. Usually, we are looking at an exceptional culture. The environment that produces world-class thinking has consistent features: immersion from a young age, visible role models, peer cultures that reward intellectual engagement, and opportunity to practice with real problems. Classrooms with a standardized curriculum and age segregation produce none of these features. The Martians were not born on Mars. They were raised in a culture that valued what they would become. We could create such cultures again. We choose not to because we believe standardized schooling is the only way to educate children.
English
48
279
1.4K
57.7K
Temitope Kolawole retweetou
0xMarioNawfal
0xMarioNawfal@RoundtableSpace·
Microsoft has released a free, open-source course: GitHub Copilot CLI for Beginners. Includes 8 Chapters covering: • Walks through of installing Copilot CLI • Using context • Creating custom agents • Working with skills • Connecting MCP servers, and more. Start Learning - github.com/github/copilot…
English
29
158
917
145.2K
Temitope Kolawole retweetou
Claude
Claude@claudeai·
We're launching Claude Community Ambassadors. Lead local meetups, bring builders together, and partner with our team. Open to any background, anywhere in the world. Apply: claude.com/community/amba…
Claude tweet media
English
1.8K
3.5K
27.8K
6.6M
Temitope Kolawole retweetou
Google for Health
Google for Health@GoogleForHealth·
Explore how generative AI can help advance your career in healthcare. 🏥 The Generative AI for Healthcare course on Google Skills covers gen AI tools, prompt writing, real-world applications, and more. Get started and earn your course badge ➡️ goo.gle/4bbb9HQ
Google for Health tweet media
English
8
138
908
46.9K
Temitope Kolawole
Temitope Kolawole@Deepthinke·
Grateful for the opportunity to facilitate a cancer biomarker discovery workshop at the CoGSAYR Conference. It was fulfilling to share practical bioinformatics skills with passionate participants and to see the level of curiosity and hunger to learn in the room. #Bioinformatics
Temitope Kolawole tweet mediaTemitope Kolawole tweet mediaTemitope Kolawole tweet media
English
1
1
3
52
Temitope Kolawole retweetou
Freud in a Slip 🇺🇸🇮🇱🏴󠁧󠁢󠁥󠁮󠁧󠁿
For those who might be struggling to understand how the theorem is magically turned into anything at all related to beliefs and evidence and biases, it might help to first see how the theorem is read: P(A|B) = [P(B|A) × P(A)] / P(B) Here's how to read it out loud in plain English in the most natural/intuitive way: > "The probability of A given B > equals > the probability of B given A > times > the prior probability of A > divided by > the total probability of B" Most common ways people say it: 1. Short & classic version "Posterior = (likelihood × prior) / evidence" 2. Slightly more verbal "The probability of A given that B happened = (probability of B given A) × (how likely A was before we saw B) divided by (how likely we were to see B no matter what)" 3. The storytelling version (often the favorite for teaching) "How much should I believe in A now that I've seen B? Well, it's proportional to • how well A explains B (likelihood), • multiplied by how much I believed in A before I saw any evidence (prior), • and then we normalize it so all the possibilities add up to 100% (divide by P(B))."
English
64
259
2.3K
192.6K
Temitope Kolawole retweetou
Deep Learning Indaba
Deep Learning Indaba@DeepIndaba·
📣 Call for Papers: Deep Learning Indaba 2026 Deep Learning Indaba 2026 is expanding its Research Track to include full-length, peer-reviewed, indexed papers, further elevating globally recognised AI research from Africa. Accepted papers will be published in a special IJCAI volume and presented at the Research in Africa Showcase. Submissions are open to original research in Machine Learning, NLP, Computer Vision, Reinforcement Learning, Datasets & Benchmarks, AI for Social Impact, and Privacy-Preserving & Trustworthy AI, especially work grounded in Africa’s unique challenges and opportunities. At least one author must be an African researcher based in Africa. One author per accepted paper will receive a complimentary attendance pass (priority to researchers based in Africa). Double-blind review | IJCAI format | 7 pages (excl. references & appendix) 👉  Submit via Charingtool: chairingtool.com/conferences/dl… 🗓️ Key Deadlines (AoE): Abstract Deadline: April 15, 2026 Paper Deadline: April 20, 2026 #DLI2026 #Indaba2026
Deep Learning Indaba tweet media
English
3
48
134
7.3K
Temitope Kolawole retweetou
All day Astronomy
All day Astronomy@forallcurious·
BREAKING🚨: This is Mariano Barbacid, the scientist who may have discovered the cure for pancreatic cancer.
All day Astronomy tweet mediaAll day Astronomy tweet media
English
2.7K
62.2K
694.8K
44M
Temitope Kolawole retweetou
Deep Learning Indaba
Deep Learning Indaba@DeepIndaba·
We are officially heading to NIGERIA! 🌟 But why Nigeria? Our 2026 General Chairs described Nigeria as a place representing "scale, imagination, and a fearless belief in what is possible." For years, Nigerian builders and researchers have helped shape the Indaba from its earliest days. Now, we are bringing the energy home to channel a new focus: Sovereign Intelligence, the ability for Africa to build, steward, and understand its own systems. As Wole Soyinka famously said, "A tiger does not proclaim its tigritude; it pounces."This year, we pounce. The journey to 2026 has begun! Stay tuned for updates on dates, venue details, and application openings coming soon! #DLI2026 #Indaba2026
Deep Learning Indaba tweet media
English
21
140
502
19.9K
Temitope Kolawole retweetou
CoGSAYR Africa
CoGSAYR Africa@cogsayr_africa·
Introducing one of our workshops at the #CoGSAYRSummit2026: Discovering Cancer Biomarkers through Transcriptomics🧬. Participants will be guided through cancer research workflows & how transcriptomic data is used to identify cancer biomarkers. 🔗 bit.ly/3W2Kfel.
CoGSAYR Africa tweet mediaCoGSAYR Africa tweet mediaCoGSAYR Africa tweet media
English
0
3
5
65
Temitope Kolawole retweetou
Dashun Wang
Dashun Wang@dashunwang·
🚨New paper out in Nature Computational Science! Introducing #SciSciGPT: an open-source, multi-agent, prototype AI collaborator designed to support research and discovery, using the science of science as a testbed. Led by the amazing @ErzhuoShao Demo + paper below! 1/n
Dashun Wang tweet media
English
16
216
903
69.9K
Temitope Kolawole retweetou
Virginio Gallardo
Virginio Gallardo@virginiog·
Comenzando el año... Con una recomendación que comparto #v=onepage&q&f=false" target="_blank" rel="nofollow noopener">books.google.com.pe/books?id=ZVO0D…
Virginio Gallardo tweet media
Español
2
182
1K
34.7K
Temitope Kolawole retweetou
Ensembl
Ensembl@ensembl·
From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA" May your celebrations be as perfectly in‑frame as your favourite gene.
English
8
98
527
33.5K
Temitope Kolawole retweetou
Mile Sikic
Mile Sikic@msikic·
🚀 We’re hiring PIs in AI × Biology The @astar_gis is expanding its AI & Computation domain and recruiting junior & senior PIs. We’re building a place where AI scientists work tightly with experimentalists to create biologically validatable models. What you’ll get: • DNA & direct RNA sequencing • Single-cell & spatial transcriptomics • Gene editing & RNA structure probing • Automated experimental platforms • Dedicated GPU clusters + access to @ASTARsg & nscc.sg resources • Close collaboration with Institute of Molecular and Cell Biology a-star.edu.sg/imcb/about-us • Stable, long-term funding in Singapore If you have a strong computational background and interest in biology, let’s talk. 📩 Send CV + short research plan. Please RT. #AI4Biology #AI4Genomics #ComputationalBiology #RNA #SingleCell #Hiring #PIPositions
Mile Sikic tweet media
English
7
51
323
25.9K
Prof Jeffrey S Morris
Prof Jeffrey S Morris@jsm2334·
Sorry that is not my experience at all. I started the way you described group B, from a single parent home with barely enough resources to live — no extra benefits or privileges. My parents encouraged me to work hard so I did and got into college, but didn’t go to elite undergraduate program. I was encouraged to consider graduate school by an undergraduate professor who saw potential in me, got into a graduate program initially planning to get an MS but did well and was encouraged to stay for PhD so did, not intending to go into academia but enjoying the research. So I applied for tenure track jobs not expecting to get one, but did. I wasn’t sure I had what it took but just worked hard on my research, identifying problems I thought were significant and ideas I thought were novel and could contribute, and was disciplined to finish work and publish and move on to the next problem. I was blessed by success and have enjoyed doing research, and had the opportunity to work on some fundamentally impactful projects. I have been well accepted by my peers in spite of my “non-elite” background, and my work appreciated and suitably recognized. I find your statement a false dichotomy Some individuals may have upbringings they give the privileges and advantages in entering this world, but I find your alternative painted as a negative and hopeless experience that has not at all been my experience, or many others I know in academia who did not come from privileged environments
English
11
2
67
19.9K
Mushtaq Bilal, PhD
Mushtaq Bilal, PhD@MushtaqBilalPhD·
There are largely two types of academics: A and B. Their worlds are so different, so insular they don't even know the other type exists. Type A: > Comes from a middle, upper-middle class family > Well-educated parents (with advanced degrees including PhDs) > Parents map out their kid's career trajectory > Parents teach academia's hidden curriculum: applications, admission essays, extracurriculars, and so on. > Send the kid to a "good" school (private or private tutoring) > Kid gets good grades > Goes to Ivy League or Oxbridge or a similar top school for undergrad > Decides to do a PhD > Gets into another top program in a top school because of top undergrad school, duh > Gets a well-connected supervisor during PhD > Gets a tenure-track job offer from another top university in the final year of PhD even before graduation because of the supervisor, duh > Fully understands the tenure clock > Publishes papers, monographs on time > Gets tenure > Thinks PhD is easy, tenure is easy, academia is easy > Marries a colleague in the same university > Has kids > The cycle repeats Type B: > Comes from a dysfunctional, working-class family > Parents who barely graduate high school > Parents with no idea what kind of education their kids need > Goes to a no-name shit school with underqualified teachers > Then goes to a community college or some such institution if lucky, joins the military if unlucky (KIA.exe) > Reads a lot, become autodidact, becomes a half-decent writer > Someone suggests, do a PhD, become a professor > Likes the idea of academic life, starts applying to PhD programs > Gets rejected from top programs because don't have good recommendation letters or connections > Goes to a third tier PhD program in a university located in the middle of nowhere > PhD stipend is not enough, has to work part-time to make ends meet > Lives in a shitty apartment, sometimes eats at the soup kitchen > Still works hard and publishes a bunch of papers > Thinks I'll write my way out of poverty > Sees a bunch of Type A PhDs in conferences, tries to "network" with them, Type A folks recognize Type B PhDs and stay away from them. > Defends PhD where the committee says this is excellent work and imminently publishable > Applies to tenure-track jobs left, right, and center. Gets rejected from everywhere > Idea of being unemployed with a PhD causes desperation > Gets a temporary teaching job, gets paid per course basis with no health benefits > Spends a few years as adjunct with semester to semester renewal of job contract > Barely survives, has to take up part-time jobs > Get a one-year postdoc, decides to turn PhD dissertation into a monograph in the hopes it will get tenure-track job > Postdoc ends, back to temporary adjunct jobs > Monograph stays incompelete, no time to work on it > Tries moving out of academia, is considered over-qualified > Reads social media posts by Type A academics saying PhD is easy, academia is easy > Thinks, what could I have done better?
English
151
570
4.2K
532.8K
Temitope Kolawole retweetou
Jonathan Jacobs 🧬🦠🕹️🏕️
Over 4,000 RNAseq and WES datasets have been added to the ATCC Genome Portal from over 900 human and mouse cell lines. All data produced in our ISO certified labs at ATCC using standardized, validated workflows. Full end to end data provenance. Every sample has structured JSONs of expert curated metadata. REST API available for queries. Need highly reproducible, benchmarked, well structured #AIready #genomics data? Learn more here : atcc.org/applications/r…
English
2
33
135
11.5K
Temitope Kolawole retweetou
Oluwatumininu
Oluwatumininu@MercyKolapo·
On the 30th of August, I had the opportunity to speak at the #Web3LagosConference organized by @Web3Bridge on Crafting Useful Products Beyond DAOs, DeFi, and Wallets.
Oluwatumininu tweet mediaOluwatumininu tweet media
English
8
9
61
1.5K