Lung Gene Therapy

Note profile update. Unlikely to post here again, but active on Bluesky bsky.app/profile/cfgted…

Note profile update. Unlikely to post here again, but active on Bluesky bsky.app/profile/cfgted…

I'm now more likely to read and post to Bluesky (bsky.app/profile/cfgted…) than here or Mastodon. bsky.app is simple to use & refreshingly sane (so far), with engagement rising rapidly. Try it, you don't need an invite.

Will the last person on Twitter please turn off the lights? Mastodon refuge in place at @cfgt_edinburgh@genomic.social

@fermatslibrary 20 years earlier, a toy mechanical computer was marketed which was able to do very simple programmable binary calculations. As a child, one borrowed from my science teacher gave me my first experience of computing. en.wikipedia.org/wiki/Digi-Comp…

In the early 1980s, Danny Hillis, Brian Silverman, and a group of friends at MIT set out to prove a point: even a child's toy could compute. So they built a fully functional computer using ~10,000 Tinkertoy pieces - no electricity, no circuits - just sticks, gears, and pulleys. It played tic-tac-toe and it was unbeatable. Designed to always win or draw, never to lose.

@BristOliver I understand an update is stalin beta.

@BristOliver ...and when the beard comes off, a tsar is shorn?

@hallaboutafrica The Lake Kariba crisis was recently covered in the Guardian: theguardian.com/global-develop…

With the giant Kariba Dam reservoir drying out, causing hours-long power cuts for Zimbabwe and Zambia, the two countries are holding a summit this week at Victoria Falls to find new sources of energy and ways to get investors to pay for them.

@JohnRentoul They seek him here: x.com/orbit_silver

Strong agree with Oliver Johnson, whose Twitter account has paradoxically disappeared bristoliver.substack.com/p/bluesky-an-a…

@jbond The KP.2-adapted version was only MHRA approved on 10/10/24 and may not be available here for some time. You'll probably have received the older JN.1-adapted Comirnaty: I had an armful of LK8841 yesterday. pfizer.com/news/press-rel… gov.uk/government/new…

Which Pfizer Comirnaty vax is going out in the NHS England Autumn '24 booster campaign. And why isn't this obvious and easily available public information? Will it be recorded in my vax record in the NHS app? Or will it be just "Pfizer - Batch xxx".

Don't want to be automatically opted in for AI and data mining here? Read on: bsky.app/profile/drlind…

I feel like this may prove to be the most prescient cartoon of the 21st century.

@ATinyGreenCell With luck, you won't even need to add Taq.

I was designing an Esp3I expression cassette to homebrew an important Golden Braid restriction enzyme and made some detection primers. I set Primer3Plus.com to 60C Tm, 25bp long, and 450-550bp optimal amplicon size. Amazingly good pair found!

Holy crap, these are the best primers I have ever seen!!! The penalty score is at the edge of Primer3Plus' standards. A penalty score of 0.000 is thermodynamically ideal according to the current algorithm and heuristics. F GATACCATTGAAGCGTACTTTCTGG R TTCAGCAGAATTTTCACATCGTTCA

Drimia maritima Asparagaceae Fars, Iran Elevation: 1300m  Yesterday, I visited this natural habitat for the first time. This habitat is located among the oak forests (Quercus brantii). You may not believe it, but yesterday, the temperature in that natural habitat reached 44 °c

Curious that answers.microsoft.com is very polite, but seldom useful.

@klausenhauser I spent a few hours free time here during a visit to CH earlier this year -- a stunning collection, of interest to all ages.

The top 10 places to visit in Zurich is actually just 1

Let me introduce: InstanSeg 🦠🔬💻👩‍🔬 This *would* have been a short thread about Thibaut Goldsborough’s PhD work… but he solved too many problems. Now it's a long thread about 2 preprints, a whole new approach to cell segmentation & #opensource software to make it easy to use

First look at the genome sequence of Greenland shark to find possible clues that could explain their mind-boggling extreme lifespan of up to 400 years. - 70% of the genome is repetitive elements - many uniquely duplicated genes, many related to DNA repair pathway - p53 is not duplicated, but the authors find some unique insertion mutation in the p53 sequence Sahm et al. bioRxiv biorxiv.org/content/10.110…

I'm pro-EU, but I think its blanket stance against agricultural gene editing works against the public interest even outwith the EU: bbc.co.uk/news/articles/…

🚨My department here in London 🇬🇧 has an open faculty position in at any level, looking for a PI in food-related bioengineering and synthetic biology. This is a really exciting opportunity that closes on Sept 22. DM me if you want to apply! Please RT 🔁 imperial.ac.uk/jobs/search-jo…

Sand patterns. A desert view is ever-changing, etched by the wind, like this Sahara vista in Mauritania. Mauritania should learn from Namibia further south on Africa's Atlantic coast and market its desert wonders to visitors.

I am never this desperate for a random number.