STEMCELL Technologies

Editor-in-Chief of the Journal of Trial and Error, Dr. Sarahanne Field, challenges one of the most entrenched incentives in research: the pressure to publish only positive results. In Season 3, Episode 4 of the Lab Coats & Life™ Podcast, she emphasizes how uncertainty makes researchers (and reviewers) uncomfortable, why “failing” to confirm a hypothesis often raises more valuable questions, and how the publishing landscape needs to evolve. If you’ve ever had a well-designed study that didn’t behave the way you expected, listen in. Listen wherever you get your podcasts!

GIVEAWAY! Win one of three pairs of our science socks.🧦 STEMCELL Science News delivers the latest research in immunology, cancer, and stem cell biology straight to your inbox. Subscribe to any of the newsletters by June 30 for a chance to win: bit.ly/3Q8FRKY

CGTACTGAGGAGGACAGCTACCTCACTAGCTACACTGAC In other words, Happy #DNADay! 🧬 earthsciweb.org/js/bio/dna-wri…

It's hard to believe that #AAI2026 is already over! 🥺 We're delighted to have seen so many of you at our workshops, poster sessions, and booths. Revisit the highlights from #IMMUNOLOGY2026 and prepare for #AAI2027: bit.ly/4v4eQs5 @ImmunologyAAI

✈️ Heading to #AACR2026 next? Meet us tomorrow at booth #4829 as we support your cancer research in immuno-oncology, tumor biology, and cell therapy. @AACR

Today is the final day at the #IMMUNOLOGY2026 exhibit hall! 📢 Swing by booth #511 for a final look at our instruments and discuss how we can support your #immunology research.

📦Transform the intracellular delivery of hard-to-trasnfect immune cells using CellPore™, a gentle transfection system to deliver target cargoes without altering cell quality. See how it works at booth #511. #AAI2026 (6/6)

🔬Ensure consistent activation, expansion, and differentiation of immune cells with ImmunoCult™. Visit booth #511 to learn more about our GMP-compliant options for immune cell culture. #AAI2026 (5/6)

Streamline your #immunology research with tools that standardize cell preparation, isolation, sorting, culture, and engineering. If you're at #AAI2026, you can come see them in action at booth #511 or explore more here: bit.ly/4v4eQs5 @ImmunologyAAI (1/6) 🧵

🎟 Still need your ticket for tonight’s #AAI2026 networking social? Swing by booth #511 to grab yours.

🚨 Our second #AAI2026 workshop starts soon! Join Drs. Amanda Vanden Hoek and Amanda Durkin to discover how gentle Highway1™ cell sorting enhances end-to-end T cell workflows. @ImmunologyAAI #IMMUNOLOGY2026

🎤 It’s podcast time! ⁣ Catch @ImmunoPodcast's live podcast on emerging immunotherapies for solid tumors at #AAI2026 today at 11 am EST!

🕺Wind down and join us for our annual #immunology networking social at Trillium in Fort Point tomorrow at 7 pm! 🎟️ Swing by booth #511 to grab your ticket. ⁣Remaining #AAI2026 events and presentations: bit.ly/4v4eQs5

Be sure to check out our second and final #AAI2026 workshop tomorrow featuring the Highway1™ Cell Sorter! 📅 April 17th at 12:45 pm EST 📍 Exhibitor Workshop Room #1 @ImmunologyAAI #IMMUNOLOGY2026

Mic check, 1, 2, 3... 🎙️ Join the @ImmunoPodcast tomorrow morning at 11:00 am in Room 157AB for a live recording with Drs. Charles Sentman and Giulia Escobar on emerging immunotherapies for solid tumors. @ImmunologyAAI #AAI2026

🥧 WHOOPIE! Need a quick pick-me-up at #AAI2026? ⁣ Visit booth #511 for a pie! Request a free EasySep™ sample, test it, then share your feedback to enter for prizes up to $3,000, and qualify for 50% off your first EasySep™ bit.ly/4sIgvBV @ImmunologyAAI

🚨 Happening today at #AAI2026! 🕥 12:45 pm EST 📍 Exhibitor Workshop Room #1 ⁣ Join us to hear Drs. Amanda Durkin, Grace Poon, and Ahmed Kabil share first-hand insights on how STEMprep™ automated tissue dissociation leads to reliable downstream analysis. ⁣ @ImmunologyAAI #IMMUNOLOGY2026