Schubes

New preprint: Cyanobacteria isolated from marine volcanic seeps display rapid sinking and robust, high density growth. Thanks to U Palermo and Two Frontiers Project, we got unique samples from Vulcano, Italy, where CO2 bubbles into the shallow ocean, 24-7! biorxiv.org/content/10.110…

An international coalition of scientists discovered a novel cyanobacteria strain adept at “eating” CO2 and sinking in water. It is a prime candidate for biologically-based carbon sequestration projects & bioproduction of valuable commodities. wyss.harvard.edu/news/newly-dis…

@LindzBro @wyssinstitute It's been awesome to hear from researchers that are getting ahold of "Chonkus" and trying it out in their lab. Wishing you all the best, and don't hesitate to reach out. utex.org/products/utex-…

Published version live today in AEM: journals.asm.org/doi/10.1128/ae… alongside some commentary from @LindzBro @wyssinstitute wyss.harvard.edu/news/newly-dis…

New preprint: Cyanobacteria isolated from marine volcanic seeps display rapid sinking and robust, high density growth. Thanks to U Palermo and Two Frontiers Project, we got unique samples from Vulcano, Italy, where CO2 bubbles into the shallow ocean, 24-7! biorxiv.org/content/10.110…

@ATinyGreenCell for commercial efforts that is an absolute steal compared to negotiating a license, i suppose. If you are using it for research/education i would get it from NCYC and only cross the licensing bridge if you ever need to?

@Schubes0 Those folks want $4500 for the strain. It's open like the OA APC of Nature, lol. What a joke!

What's a good IP-free yeast cell line I can play around in? My client has me diving into some yeast work and I'd love to have clearance for both commercial and open source educational product dev. Can be brewers or other species. I don't know enough about yeast to have pref TYIA!

Once again seems to have aged poorly, this time recent Nobel News.

@ATinyGreenCell I have used these pubmed.ncbi.nlm.nih.gov/23727987/ and like the way they measured their activity. Many different sequences.

What's your favorite rho-independent bacterial terminator? The iGEM BioBrck B1006 is a pain to PCR since it's a tight hairpin. I need a few alternatives. TYIA! PS: Here's the B1006 terminator; it's a fantastic little loop! >B1006 AAAAAAAAACCCCGCCCCTGACAGGGCGGGGTTTTTTTT

Can we settle once and for all how to pronounce "-mycin" antibiotics?

@ATinyGreenCell denovoDNA.com predicts pKanR at ~5k units, pAmpR at ~2k units, and the strongest promoters i've seen are maybe ~12k units. not perfect prediction, but generally a good vibe check

Before I go into a history dive to find the info, does anyone know the transcription rate of the kanR promoter often used in plasmids? How strong is it? >PkanR (5'->3') AAAGCCACGTTGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTT

@ATinyGreenCell Same vibes: youtu.be/aAwJlD-m_hE?si…

lol why god why

@ATinyGreenCell Truly amazing and I agree. At the same time, I think future biologists will find PCR barbaric “you would fully DENATURE the DNA and then SMASH it back together? Like 30 times?” Potentially isothermal or synthesis will overtake it?

I call this program "Boring PCR" but the fact we can amplify DNA in a tiny tube using proteins from some scum found in a boiling pond is astounding.

@TLowePower Not always the most possible/practical, but have DIY on your list of possibilities. Outfitting a fridge with a pet store heating pad with heat/cool on a hardware store controller will run you less than $500 and fridges are available in countless sizes.

@kaia_mattioli Incredible news! hope to celebrate with y’all soon.

this morning I received the notice of award from NHGRI for my F32! ☺️☺️ feeling very thankful for my wonderfully supportive, super sharp advisor (not on twitter) & my team of collaborators!! now to do some science 😅 i am coming to interrogate u, alternative TF isoforms

Lol also if you are interested in hearing me blubber about this on local radio have a listen (segment starting about 37:00) kpfa.org/episode/a-rude…

Tagging @izzymgm @ZijayTang @bradentierney @geochurch @mason_lab @MeclabU @twofrontiers @krista_ryon @seedhealth @wyssinstitute @jkowitz and more- ongoing updates to the story forthcoming.