Oscar Martinez

Marathons run: 1997 San Sebastian 2h52’ 2000 Barcelona 2h38’ 2003 Marine Corp’s DC 2h45’ 2020 El Prat 3h17’ 2021 Barcelona 3h08’ 2022 UltraPirineu 8h00’ 2023 Athens 3h28’ 2024 San Sebastian Cancelled 2025 Rome 3h33’ Next Edimburg 2026 #RunningMan

Aptadel Therapeutics capta 2 M€ per desenvolupar el seu fàrmac contra el sarcoma d'Ewing ara.cat/economia/farma…

@nedgia Más de 48h sin servicio de gas en casa sin previo aviso por falta de una inspección concertada a la que nunca se presentaron. Llevo 3 dias llamando a atención al cliente y la respuesta es prioritario le llaman hoy. Todavia esperando…Donde denuncio @gencat ?

Ponència “Innovació: del laboratori al pacient” Participen: STAb Therapeutics, Belén Blanco; STAb Therapeutics, Elena Barba; IDIBELL, Òscar Martínez-Tirado; Aptadel Therapeutics, Gisela Llorente. La recerca es transforma en solucions reals per a les persones #contraelcancerbcn

60 ajudes. 13,11M€ el 2025. 68,62M€ en desenvolupament a Barcelona. La supervivència depèn de la recerca. Seguim! #contraelcancerbcn

A new paper reveals that adhesion GPCRs promote extracellular vesicle (EV) formation and EVs spread GPCRs into neighboring cells to activate G-protein signaling, providing a novel mechanism for cell-cell communication nature.com/articles/s4158…

Esto es magnifico, pero un plan para aumentar el raquítico presupuesto actual sería de gran ayuda para todos los científicos

In preclinical models of neuroblastoma, SCLC, and colorectal cancer, we observe reduced tumor growth, improved survival, and signs of ICD. Link:link.springer.com/article/10.118… @CNIOStopCancer @BioInn_CIEMAT @SpringerNature @BioMedCentral

@AAytesLab Pues no se porque lo dices.....😅

Por los pacientes y sus familiares, para no abundar en su frustración y sus miedos, igual hay que replantear la communicación de la investigación biomédica…. Un poco de prudencia no estaría de más.

Now that everyone is an expert on curing pancreatic cancer in mice, not rats - I want to add some context that goes beyond the headline. You will want to read this. Cancer is cured in mice all the time. Thousands of times. ~90% of those “cures” fail in humans. Why? Because mice are: Genetically simpler. Treated earlier. Short-lived. Not humans. Mice are a filter - not a finish line. Yes, this study matters. It comes from the Spanish National Cancer Research Centre. Yes, it’s pancreatic cancer - one of the deadliest there is. Yes, full tumor regression is impressive. But here’s what it actually means: “This approach is now good enough to risk years, trials, and millions of euros on.” Not: “Cancer is solved.” What happens next? More animal work. Toxicology. Phase I (safety). Phase II (maybe works). Phase III (beats standard care?). Maybe 8-10 years if everything goes right. The real damage isn’t failed drugs. It’s failed expectations. Every “cured cancer in mice” headline trains the public to believe: Cures are being hidden. Progress should be fast. Scientists are lying when reality hits. That’s how trust erodes. Bottom line: This is how real cancer progress looks. Messy. Slow. Risky. Incremental. Not miracles. Not conspiracies. Just science - doing the hard work.

Oh my!

The Viladecans Association Against Cancer allocates the money raised in 2025 to research against colorectal cancer🙌🤍 Since 2016, the Association has collected +200,000€ for IDIBELL's research: a real driving force. Thank you very much! 👉idibell.cat/en/2026/01/the…

🧬 Cell therapy in #sarcoma: what do we know so far? In our review in @jitcancer we cover ✔️TCR-T, CAR-T, TIL, NK-cell approaches ✔️Early clinical studies ✔️Key biological & practical challenges, inc. the tumour microenvironment ✔️Emerging directions 🔗 jitc.bmj.com/content/14/1/e…

To end the year I’d like to share our last work, comments are welcome. Many thanks to all the magnificent researchers involved! biorxiv.org/content/10.648…

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA" May your celebrations be as perfectly in‑frame as your favourite gene.

@Pucurull Per molts anys Pucu!!! Ets un exemple a seguir!!

Avui faig 87 anys. Per celebrar-ho me’n vaig a córrer/corrinyar/caminar 87 minuts.

🔥 Your entire immune system starts with one cell. Every red blood cell that carries oxygen Every platelet that stops a cut from bleeding Every neutrophil that attacks bacteria Every T cell that hunts viruses Every B cell that makes antibodies All of them come from the same origin: a single pluripotent hematopoietic stem cell hidden inside your bone marrow. 🩸 What this stem cell can become With the right signals from molecules like IL-3, GM-CSF, IL-7, SCF, and others, this stem cell divides and chooses a path: • Red blood cells to deliver oxygen • Platelets to form clots • Neutrophils, eosinophils, and basophils to fight infection • Monocytes and macrophages to clean up dead cells and debris • B cells that produce IgG, IgA, IgM, and other antibodies • T cells that orchestrate your immune defense • Natural killer cells that recognize and destroy infected or malignant cells Every branch in the diagram is a decision point based on the chemical signals surrounding the cell. 🧪 Why this matters Your energy, your immunity, your ability to heal, and your resistance to infection depend on how well this system works. When hematopoiesis is disrupted, it can lead to: • anemia • weakened immunity • autoimmune problems • slow healing • susceptibility to infections • blood cancers Healthy blood begins with healthy stem cell signaling. Inside your bone marrow, millions of stem cells are working every minute to build your immune system from scratch. It is one of the most complex and elegant engineering systems in the human body.

🧬 La #innovación impulsa nuevas soluciones en el ámbito terapéutico 🤝Con #AyudasCDTI y los #FondosEuropeos #MRR impulsamos proyectos como el de @aptadel 🔬Desarrollo de una plataforma de aptámeros conjugados con #RNAS terapéuticos para nuevas estrategias frente al #cáncer 👉 aptadeltx.com 💡Apoyando con ayudas #NEOTEC: acortar.link/PGAvBD @CienciaGob @P_Recuperacion #AyudandoCrearFuturo #nextgenerationeu #MRR #PRTR #subvención #tecnología #innovación #salud #Agenda2030 #ODS3

Nearly a decade after the foundation of special relativity, Albert Einstein submitted his paper 'The Field Equations of Gravitation' for publication #OnThisDay in 1915, which gave the correct field equations for the theory of general relativity. In actual fact, the German mathematician David Hilbert had submitted an article containing the correct field equations for general relativity five days before Einstein. Hilbert never claimed priority for this theory. Image: Public domain, created by NASA - National Aeronautics and Space Administration. High-precision test of general relativity by the Cassini space probe (artist's impression): radio signals sent between the Earth and the probe (green wave) are delayed by the warping of spacetime (blue lines) due to the Sun's mass.

Thrilled to share that our PROVABES study is now published! We prospectively validate 1q gain and genomic instability as strong outcome predictors in a large series of #ewing #sarcoma cases form EuroEwing protocols. @LabHuvr @ibis_sevilla @HospitalUVRocio sciencedirect.com/science/articl…