DcGC will no longer be posting on this platform. Account remains as an archive.
We'll be further communicating our news on:
- Website genomecenter.tu-dresden.de
- LinkedIn linkedin.com/company/dresde…
English
DRESDEN-concept Genome Center
143 posts
DRESDEN-concept Genome Center
@DcGenomeCenter
+ + + not actively maintained anymore+++ DRESDEN-concept Genome Center (DcGC) Joint NGS technology center Part of the German NGS Competence Network
Dresden, Germany شامل ہوئے Mart 2021
45 فالونگ237 فالوورز
DRESDEN-concept Genome Center ری ٹویٹ کیا
Publication in @Nature with the participation of @mpicbg. The genome of the lungfish was sequenced and assembled by Gene Myers @TheGeneMyers, Director Emeritus @mpicbg, and the team of the @DcGenomeCenter.
Universität Konstanz@UniKonstanz
Team led by #UniKonstanz Axel Meyer & @Uni_WUE Manfred Schartl sequenced the largest animal genome: 30x the size of the human genome, it belongs to a lungfish. Their data help to explain how our Devonian fish ancestors made their way onto land. @Nature: uni-konstanz.de/en/university/…
English
@DcGenomeCenter @PacBio That's 124 8M SMRT Cells on @PacBio Sequel II x 30hr movie times = 3,720 hours.
so... 155 days?
It's crazy to think that using @PacBio Revio this project could be done in 6 days using ~24 SMRT Cells (~90Gb per cell)... 🤯🤯🤯
English
Proud to announce new records to our portfolio: the massive genomes of the South American (91Gb) and African lungfish (47Gb) are now published in @Nature!
Big kudos to our long-read lab and bfx teams who made it happen!!
#paperalert #genomics
nature.com/articles/s4158…
English
And now to the audience: I challenge anyone to guess how long it took to sequence these beasts!! 😊
(hint: using @PacBio, we generated 2.2Tb of data from 103 HiFi SMRT cells and 2.8Tb from 21 CLR SMRT cells)
English
This work was part of a @dfg_public sequencing grant, we were thrilled to have worked with such amazing scientists! @EvoLab_Konstanz et al.
Also a shout out and huge thanks to our @NGSCN_de colleagues from @NCCTuebingen, who jumped in for help with the sequencing 👊
English
DRESDEN-concept Genome Center ری ٹویٹ کیا
Great news! @dfg_public offers opportunities to apply for funding high sequencing costs projects together with academic sequencing institutions e.g. @DcGenomeCenter | @WGGC_de |
@NCCTuebingen | @CcgaKiel
Excited? Check here dfg.de/de/aktuelles/n…
English
We - and our @NGSCN_de colleagues @WGGC_de @NCCTuebingen @CcgaKiel - will of course be thrilled to continue to support your research!
So, get in touch with us if you have an exciting scientific idea using omics!
English
News on the future of DFG funding for NGS:
1. yearly sequencing funding calls are discontinued, INSTEAD seq budget (100k - 1mio) can now be planned in any regular project;
2. seq centers should be co-applicants;
3. all seq centers in Germany are elegible.
dfg.de/de/aktuelles/n…
CCGA Kiel@CcgaKiel
In case you were wondering what the future of DFG sequencing calls will look like: DFG just announced it! You are free to work with other sequencing centers as you wish, but we and our colleagues in the sequencing network @NGSCN_de @DcGenomeCenter @WGGC_de @NCCTuebingen would
English
@fabianrost84 @MeriHuchlab @mpicbg Much success in this new position, Fabian! We will miss you - but luckily you are just across the street :)
English
Excited about my first day in the @MeriHuchlab at @mpicbg. Exciting times ahead!
English
CACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGG!
Our team wishes you a wonderful and successful 2024! We are looking forward to many exciting new projects and collaborations :))) #frohesneues
English
DRESDEN-concept Genome Center ری ٹویٹ کیا
🎧 All sketches for the released Explain Podcast episodes can be found on our Insta @explain.pod
You're welcome! instagram.com/explain.pod
Choose the platform to listen to a podcast - Spotify supports chapters!
ngs-kn.de/explain-podcas…
English
It was our pleasure to host such a fantastic line up of speakers!
Artür Manukyan@arturman_sl
I would like to thank @DcGenomeCenter for the invitation. So many talks with image alignment being used to integrate multiomic spatial data, even with EM images @AndrovicPeter @ozgungokce We had a chance to present VoltRon and our research on lung as well.
English
DRESDEN-concept Genome Center ری ٹویٹ کیا
Become part of the #GHGAsquad at @uni_tue!
We are looking for a scientific project manager at our data hub in Tübingen, supporting our central project management team and training efforts!
More at ghga.de/about-us/jobs
English
Our #LIMS system got a major backend improvement, thanks to the magic brains & hands of our IT experts!
At the frontend, the main diff. to users is the new name, Rosalind, our team's tribute to #RosalindFranklin, one of the greatest #womeninscience and role model to many us.
GIF
English
DRESDEN-concept Genome Center ری ٹویٹ کیا
Join us for the upcoming @mpicbg & @PoLDresden symposium on Machine Learning in Biology, November 29th, taking place @mpicbg. Everybody is welcome!
English
couldn't have done it without the support from @tudresden_de, @CRTDpress, @mpicbg, @BIOTEC_TUD @PLID_Info, @Medizin_TUD, @DRESDEN_concept, @NGSCN1, @dfg_public and all our collaborators in Germany and abroad!
English
Today we celebrate our 5000th project with cake!
It's a big achievement for us, we are proud to see how far we came in making the DcGC into an excellency hub for #genomics in #Dresden!
Thank you all for your support and trust throughout all these years!
#selfhighfive
English
If you are interested in #biodiversity and #genomics, one or the other, or even wondering how they come together... make sure to watch this seminar:
*proudly sponsored by the @NGSCN1 😉
West German Genome Center@WGGC_de
-NGS webinar series- 9th November Thursday 11:00 CEST ...online-meet Philipp Schiffer - BioC2 priming biodiversity genomics in Germany. Register hhu.webex.com/weblink/regist… #ngscnjoin #ngscnwebinars #nextgenerationsequencing #genomics #ngstechnologies #transcriptomics
English
Our very first @10xGenomics #Xenium experiment being presented at the AGD Meeting! Exciting results are building up!!
AGD e.V.@AGD_eV
@DcGenomeCenter presents exciting results using a spatial multi-omics approach on 'Characterising the immune architecture of melanoma metastases'
English