Kiril Poukalov

@TheKoshurDoc We need to know the cerebrospinal pressure during the movement too. If I recall correctly, pressure is transferred in valsalva during exercise.

Here is the link: pubmed.ncbi.nlm.nih.gov/7741618/ This was a BP recording in a male athlete performing heavy weightlifting with a closed glottis. P.S. Not a “patient”.

The highest blood pressure reading recorded in a surviving patient, as documented in scientific literature, is 370/360 mmHg.

@endless_frank put out some peanuts and they'll never leave

$ASTS 👀 Very odd, have never seen these before. A couple of beautiful “Bluebirds” just landed in my yard. Going to be a crazy week. 🚀🚀🚀

@techinvestoor @whitelightfrom @Allan_Reine @davidrliu good luck with your investment, I hope for the sake of the patients that it works outs.

@techinvestoor @whitelightfrom @Allan_Reine @davidrliu Targeted delivery is my field, progress is not being made "just fine"

@whitelightfrom @techinvestoor @Allan_Reine @davidrliu Exactly, extrahepatic delivery is key for all these gene editing companies and none of them have anything close to a solution. The market for liver diseases is very small and they're all fighting over it.

@KPoukalov @techinvestoor @Allan_Reine @davidrliu I feel very confident the in vivo liver stuff will work brilliantly. The 100b upside is if they can prime edit not only the lungs (one of the recent job postings refers to lung nebulizers so i think this is actively being worked on) but the CNS. Open question

@techinvestoor Good Luck

@Biotech2k1 All these CRISPR companies are hopeless until one has efficient extra-hepatic non-viral delivery.

I sold $BEAM today. I had planned to sell it as its still too early stage for my new strategy, but hoped to sell it higher before the Intellia disaster. I think this just confirms my concerns on this space.

Ledger of Investing Decisions: Block 4

@zhaoweiasu Convoluted and biased explanation.

A plausible explanation for the severe adverse event from NTLA-2001 triggering Hy’s Law—and why base/prime editing should be much safer $NTLA-2001 uses Cas9 to create indels that knock out the TTR gene. In NEJM, 98.9% of edits in NHPs were a +1 frameshift. The gRNA differs by just one base: 🧬 NHP: ACACAAATACCAGTCCAGCG + AGG 🧬 Human: ACACAAATACCAGTCCAGCA + AGG If humans share the same dominant frameshift, it would produce a short peptide LLLLCLAWTGICV—nonfunctional, but potentially visible to the immune system. GPT-5t reasoning: • LLCLAWTGI and CLAWTGICV fit A*02:01 MHC-I motifs (L@P2, I/V@P9). • LLCLAWTGI → likely immunogenic in A2⁺ individuals. • CLAWTGICV → plausibly weaker but still credible. • Frameshift mRNA should trigger NMD, yet in rare individuals, some peptides may still be presented. 👉 Why NMD is not enough: In reporter assays, a premature stop codon typically reduces mRNA to ~5–30% of wild-type levels (a 5–20× drop), but endogenous genes show much more variable decay—often only 30–70% degraded. Because NMD acts after at least one round of translation, small amounts of truncated protein can still be produced before decay. Moreover, NMD is probabilistic: within a single cell, some transcripts escape entirely, allowing occasional expression of aberrant peptides like LLLLCLAWTGICV. 🔴 Given the day-24–35 window when G3/G4 patients showed liver injury, the timing is too late for a direct LNP reaction or Cas9-specific immune response—suggesting a secondary adaptive response. Implications: 👉 For NTLA-2001: HLA-A*02:01 carriers—present in roughly 25–30% of individuals of European descent—could face a real CD8 T-cell risk. If not A2-like, the risk falls quickly unless another allele happens to recognize one of the other 9/10-mers. 👉 For gene editing overall: base and prime editing minimize random indels, greatly reducing such risks by design. 🏁 In short, for NTLA-2001, the persistent expression of a novel peptide from the on-target frameshift may have provoked an autoimmune response that destroyed the edited liver cells. Because this indel is the inevitable product of nuclease editing at that cut site, it cannot be engineered away. In contrast, base and prime editors can precisely install a premature stop codon—silencing the gene without creating new foreign amino acid sequences.

@Biotech2k1 @biosleuth I am a scientist. No one can predict the reaction to a vector because their mechanisms are varied and not well understood.

@KPoukalov @biosleuth Anyone who knows the science can. That is why we have doctors and scientists.

The $NTLA news has no bearing on $QURE 's HD program. Generalizing all gene therapies in the same basket is insanely stupid.

@Biotech2k1 @biosleuth It's not and you can't because no one can.

@biosleuth I could explain it to you if you like. Its basic science of vectors, immunology and metabolism.

@Biotech2k1 The big limitation is delivery, that's why all these companies are floundering trying to target the same handful of liver diseases. Profiling off-target editing is straightforward and new editors are higher fidelity.

Gene Editing is very exciting technology, but the big question should be safety. They are permanently altering the cells of a person. Any side effects will thus also be permanent. We already see spikes in liver enzymes with all these editing therapies. The big question will be, "How safe will this be in 5, 10 or 15 years from now?" I suspect that many of these early patients will end up with liver cancer later in life. Too many other safer therapies that don't cost nearly as much. Then comes the issue of profitability and acceptance. Yes, I am fully aware that I am whacking the "fanatical" beehive with these comments, but they are true and real. Any serious investor will take them seriously.

@Biotech2k1 The technology for in-vivo gene editing simply doesn't exist for any tissue besides liver. But that won't be the case in 5 years.

To be honest, the more time I spend looking at gene editing the less excited I am by it. They have a huge challenge for adoption and reimbursement. They are much harder and more costly to manufacture in quantity. They have lower margins. Most of them compete with each other in the same few indications due to limited vector tropism. Then you throw in competition with other modalities like small molecule, antibodies, RNAi and TPD. The more I look at old school small molecule companies that can cheaply manufacture billions of dollars worth of drug at low cost, the more I appreciate older modalities. As an investor, I have to invest where the most money can be made. Today, I am not so sure gene editing will ever be that big winner.

Happy Halloween from the Olson Lab! @UTSWMedCenter

@Biotech2k1 The expansion of M2 in 2020 was much greater than at any other point in the past 60 years. It definitely contributed to inflation but that's not to say inflation will return after rate cuts.

Money printing and high deficits have existed for more than 30 years. Neither led to inflation. Anyone betting Government spending will cause wild inflation will be wrong.

For nearly 30 years low rates and low inflation have existed together. Only 2 time in history have we had high inflation. Both were supply/demand imbalances. Anyone betting inflation comes back because of lower rates wil be wrong.

@Biotech2k1 👍

Since I have a lot of new followers, Here is my open post. I only allow people I follow to reply because it blocks out all the bot spammers. If you want me to follow you so you can reply to my posts, just reply here and I will.

Happy to announce my PhD work is published!🎉 @PNASNews : Myospreader improves gene editing in skeletal muscle by myonuclear propagation pnas.org/doi/10.1073/pn…

So excited to finally see this work published! 🙌 #PLOSONE: An optimized approach to study nanoscale sarcomere structure utilizing super-resolution microscopy ... dx.plos.org/10.1371/journa… #myotwitter

@CollinDouglas13 Really nice work Collin! looking forward to using this

Now online! A versatile CRISPR-Cas13d platform for multiplexed transcriptomic regulation and metabolic engineering in primary human T cells dlvr.it/T35n3V