Patrick G.S. Grady, Ph.D. (he/him)

🚨Paper Alert🚨 I am excited to share our new paper published in Bioinformatics. Deep statistical modelling of nanopore sequencing translocation times reveals latent non-B DNA structures academic.oup.com/bioinformatics… @nanopore @UConn #ISMBECCB2023

@JillWegrzyn Thank you! 😁

New title just dropped ⬆️

😁 Huge thanks to everyone who helped me along the way

Dissertation IN. Two weeks to go!

Less than one month to dissertation defense time! Can't wait! Will be local at UConn in ESB and via Zoom on July 21st at 9:30 EST. DM for the link if you'd like to watch!

During his talk, @patrickgsgrady discussed assembling telomere-to-telomere genomes & epigenomes across multiple marsupials. He also discussed his research into marsupial-specific centromere & repetitive element structures using nanopore sequencing: nanoporetech.com/resource-centr… 3/4

@biodiversityge1 Yep you definitely said it exactly right! 😁

Hey @patrickgsgrady, you saw this right? Do you see what I mean? Go big, my friend!

@Nemasoil Is this you telling someone they shouldn’t be posting their own free speech and dehumanizing those who live outside the gender binary? Seems a bit counterintuitive to your argument to respect all viewpoints.

I just listened to this incredible holocaust survival story and thought of how important it is not to demonize and dehumanize one another because we are one human race, one human family. We need to allow for freedom of speech and freedom of religion if we want to continue living in a free society. Human nature has not changed since the 1940's, it was ideology that caused this to happen. It was scientific racism derived from Darwin that taught that some races where inferior, it was the idea of the common good, the focus on the group and not individual rights that caused this, and it was also because of people being silent. Let's learn, let's allow others the freedom of religion and speech. I have been surprised by the current intolerance and demonization happening right now. Because I am Christian and my values are very different than what are mainstream in academia, I have been insulted and even told I don't deserve to live. People like me are being dehumanized. Please, let's treat each other well and support freedom of speech and religion. Those you disagree with, just debate them and persuade them with evidence and logic. Don't silence them. Don't support censorship. Allow for speech that you despise because that is the only way to have a free society. youtu.be/vfb5DUIEahQ

4 weeks of writing left…..I think I might hate my thesis. Like it’s not bad, I just hate it

The first Pride was a riot in 1969, and the LGBTQIA+ community still has to protest for equality & represent for those of us who can’t be ourselves. June is never enough! End the worthless culture wars.

Nah it’s nothing like this! 🫣

Now that researchers have released a human pangenome reference, what’s next? Well, a lot more research to advance human health around the globe.

43,000 words and I feel like I have so SO much more to say...writing a PhD thesis is a bitch. Can't wait for this to be over with!

Protecting our biodiversity is arguably the most pressing issue of our era, that’s why we’re signal boosting this subject in recognition of International Biodiversity Day. 🌎🌿🦭🪲 #science #conservation #startups #internationalbiodiversityday

And then there will be me, just printing (CATCATCATCATCATCATCATCAT)n and giggling away to myself

This is THE coolest program. Undergrads & grads working as a mini-consortium to produce an amazing genome with @nanopore Org.one data. I was lucky to see the genome developing! Congrats to on the amazing program @JillWegrzyn and the great work @ScienceyNeitzey 😁

Just need some ultra-long nanopore to close those remaining gaps - I know a lab producing some crazy long reads @roneilllab 😉 businesswire.com/news/home/2023…

@edgrady It's not really a floor!

@patrickgsgrady Don't kid yourself Jimmy, if a cow ever got the chance he'd eat you and everyone you cared about.

Sometimes I feel like two day conferences are great, and sometimes they feel like this

@rgrubinstein Yes!! I pointed it out to my seat neighbors and said “where do I get that!!!” 🙂

for all those cool cats who loved my DNA pride pin at #nanoporeconf, I got it from this lovely seller on Etsy! wouldn’t it be cool if we all wore one next year?! etsy.com/listing/712298… 🏳️‍🌈🧬