Paula Clemente

"Planet Earth: You. Are. A. Crew." Artemis II mission specialist Christina Koch reflects on what it means to be a "crew."

Welcome home Reid, Victor, Christina, and Jeremy! 🫶 The Artemis II astronauts have splashed down at 8:07pm ET (0007 UTC April 11), bringing their historic 10-day mission around the Moon to an end.

🚨 Primera convocatoria del Premio Sols-Morreale que promueve el #IIBmCSICUAM Este premio reconoce la excelencia y la trayectoria en investigación biomédica 🗓 Plazo: del 10/04 al 22/05 Bases, presentación de candidaturas y más info ⬇️ iib.uam.es/short?i=YNeHJR

Earthset. The Artemis II crew captured this view of an Earthset on April 6, 2026, as they flew around the Moon. The image is reminiscent of the iconic Earthrise image taken by astronaut Bill Anders 58 years earlier as the Apollo 8 crew flew around the Moon.

To commemorate the Artemis II mission, the astronauts announced their suggestion to rename certain features on the Moon to honor the Orion spacecraft, named Integrity, as well as commander Reid Wiseman's late wife, Carroll.

Even we have to agree with this.

We see our home planet as a whole, lit up in spectacular blues and browns. A green aurora even lights up the atmosphere. That's us, together, watching as our astronauts make their journey to the Moon.

📰 Abierta la convocatoria JAE INTRO 2026 del CSIC Una oportunidad para que estudiantes de grado o máster se inicien en investigación científica en centros CSIC. 🔹 240 becas disponibles 🔹 Estancias en grupos de investigación 🔹 Inicio previsto en el último trimestre del año

🔬 Becas de introducción a la investigación JAE-INTRO ICU 2026 (lnkd.in/e9X2Yqsy). Si tienes interés por la investigación en biomedicina y por el estudio de las bases moleculares de las patologías humanas ofrecemos una plaza en nuestro grupo. 👉 JAEINT26_EX_1019.

Muchas gracias a todos los ponentes y asistentes por una jornada fantástica.

📢Hoy en las Noticias del #IIBM 🌟Resumen de la III Jornada sobre Enfermedades Raras. Investigadores básicos y clínicos y asociaciones de pacientes unidos para impulsar nuevas terapias. @FundameNet @AMadFQ No os lo perdáis: 👉 iib.uam.es/short?i=nVrkCT

III Jornada sobre Enfermedades Raras en el #IIBM Con motivo del Día Mundial de las Enfermedades Raras 2026, el Departamento de Enfermedades Raras organiza este evento para compartir avances y nuevas terapias. 🗓️ 26 feb | ⏰ 9:30–14:30 📍 Salón de actos Gabriella Morreale, IIBM

📢 Hoy arranca en el #IIBM la II Reunión de la Red de Enfermedades Raras @Raras_CSIC 📅Hoy tenemos sesiones sobre medicamentos huérfanos 💊 e IA aplicada a la investigación en ER 📊y dos conferencias plenarias sobre estos temas🌟. Ciencia colaborativa para avanzar juntos 💙

From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA" May your celebrations be as perfectly in‑frame as your favourite gene.

Las universidades y el futuro de Madrid elmundo.es/opinion/column…

Today in @Nature we report a new prime editing strategy that can rescue a common cause of many genetic diseases in a disease-agnostic manner. This approach converts a redundant endogenous tRNA into an optimized suppressor tRNA, enabling a single prime edit to rescue premature stop codons across different diseases. (1/15) drive.google.com/file/d/1bSvkJW…

@Dolmeda @SanchoLab @CNIC_CARDIO @CSIC @CSICdivulga @DLGMA_CSIC @UAM_Madrid @UCCUAM @FatlivL @TIglesiasLab @IGIUMAoficial @InfoUMA @Cris_P_M_ @plopezlarrubia @SMART18617738 @GemaMorBue 💙 And finally… the group photo! Not everyone made it 🫢 , a few had already left before the picture (and the weather didn’t help ☔), but here’s a great snapshot of the #RetreatIIBM_2025 spirit: science, laughter, and collaboration! 🌟 💫See you all, next year! 👋#IIBmCSICUAM

@Dolmeda @SanchoLab @CNIC_CARDIO @CSIC @CSICdivulga @DLGMA_CSIC @UAM_Madrid @UCCUAM @FatlivL @TIglesiasLab 🎙️ Invited Plenary Lecture 2, chaired by Cristina Peña Prof. Susana Guerrero Salazar: La importancia del lenguaje: Inclusión, Identidad y Comunicación 💬 An excellent and enriching lecture, full of insight, warmth, and inspiration on the power of language and inclusion. 🌟

🚨Attention Molecular Biology Researchers🚨 Submit your manuscript to EMP & contribute to advancing cutting-edge biomedical research! Learn more about our expanded scope here: sciencedirect.com/journal/experi… @ELSpharma #MolecularBiology #CallForPapers #BiomedicalResearch #Elsevier

FlyBase funding thetransmitter.org/community/flyb…