Pedro Tizei

@devcayer @shelbynewsad Do you mean something more like unit operations from industrial processes? Ie, each device in a chain is specialised for doing one thing very well, instead of something like the big tip based liquid handlers that are expensive and slow? I've been thinking along these lines a lot

@shelbynewsad 💯 for single use widgets - complex input and complex outputs will slow down velocity. Praying for a company that makes single transformation building blocks as a service

a friend asked me recently about the business of selling new hardware to biotech companies and whether this was a venture scale business. from studying the market, my takeaway from new hardware is that it requires many companies to change their current hardware they spent 6-7 figures on already. not only this but the sales are hard bc automation people aren't that senior so you get stuck between automation people and c-suite in sales process. this doesn't mention the one-off vs. recurring payments you get in other lab adjacent businesses such as software or repeatable services. this is why I'm excited about companies using automation to make step change CROs. put another way selling services not hardware. an example is plasmidsaurus and think similar companies can be built on different layers of chemistry, therapeutic assays, and animal testing. on the bigger company side, Ginkgo and Emerald also seem to have a general experimental offering that's exciting to see and has some solid traction to boot. in a way, I see these centralizing experimental workflows but still thinking about centralized experimentation vs. decentralized trials.

@stevesi Is there any published/recorded retelling of this part of the Surface strategy by Microsoft? I've been thinking a lot lately about how great it would be to have an org setting standards for the ecosystem and supplying quality parts for OEMs, but on the biotech equipment vertical.

@ATinyGreenCell @TomKnightSynBio Whaaa? There's vendors that charge for the iupac coded mixed bases? I only remember ever getting them from IDT and it was free to get them mixed automatically in the synthesiser. Only the hand mixed version with more accurate frequencies was charged, a lot iirc.

@TomKnightSynBio Yeah degen primers are crazy expensive so I chose the ecoli base (one site) and only consider the amplicon past the priming site as viable for BLAST. Another reason why I just amplify the entire 16s via long primers. Cant believe how much they charge for degen pool!

No luck finding them so gonna order a fresh set. Here are the primers I use, 5'->3': 16s-27F AGAGTTTGATCCTGGCTCAG 16s-338R TGCTGCCTCCCGTAGGAGT 16s-1392R GGTTACCTTGTTACGACTT 16s-longRG-FCCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG 16s-longRG-R CCCGGGATCCAAGCTTACGGCTACCTTGTTACGACTT

@NailYourShoes @owl_posting Ohh yes, good shout! I actually left Discworld aside for like 2 years after trying to start on Colour of Magic, which I enjoyed but just didn't quite hook me into the universe. Then I got FOMO hearing so many good things about Discworld and it only really clicked after Guards!

@ptizei @owl_posting ^^ Immediately thought of Terry Pratchett. Discworld is wonderful, I usually recommend starting with Guards! Guards! over Color of Magic but either one works tbh

what book should i read? my criteria is that it teaches you nothing, has great writing, and the author clearly had fun with it. this last point is extremely important

@WeiseFranklin Faltou outro detalhe bem relevante aí... a outra pessoa que dividiu esse Nobel foi o pai dele!

Um infográfico com o que realmente importa: idade dos vencedores do Nobel de Física ao longo dos anos.😀 E assim descobri que o vencedor mais jovem foi Lawrence Bragg, aos tenros 25 anos. E que, entre outras coisas, ele era fã de jardinagem - tanto que trabalhava como jardineiro como bico nas horas vagas (não que precisasse, pois tinha uma posição sólida na academia).

@Tinafar @jrkelly Is that government investment/subsidies for biotech infrastructure? I haven't read anything about that recently, do you have some links I could read to get me started trying to understand this?

@jrkelly 💯The amount of investment in Chinese biotech is almost unfathomable. The missing link that is infrastructure is being provided at scale to Chinese companies, whereas US/Canadian companies have to build much of this from scratch.

This is the most important story in biotechnology right now. We're losing the startup biotechnology ecosystem to China -- US biotech VCs are opening offices in China and large US Biopharma companies are acquiring Chinese startups (30% +of new acquisitions!) which pushes $$ back into that ecosystem. Meanwhile 30% of biotech lab space is vacant in our biotech hubs and funding of US biotech startups is at its lowest in years. This would all be a reasonable trade if there was a huge international spend on drugs that made this a global market but the US is in control of the end market for drugs as we are the ones who pay our fair share for drug development. We should flex our muscles here and keep biotech innovation in the US. I don't see how limiting these acquisitions of Chinese companies will create any chaos as is being suggested in this article -- this isn't about drugs on the market today -- it's about the next generation of innovative medicines. For every one of these Chinese startup biotech's there is are several US competitors with a similar asset that just pays more for scientists, lab space and regulatory so is a more expensive acquisition. Slowing or stopping these acquisitions won't be chaos -- it will just be worse returns for people that invest in Chinese startup biotechs and better returns for people that invest in US startup biotechs. If China wants to maintain a biotech ecosystem they should pay more for drugs (like we do in the US!) and support that ecosystem. It was a mistake when we did this the first time around in the tech industry 20 years ago -- with some US tech VCs backing Chinese tech startups and building that ecosystem -- we shouldn't repeat the same mistake with biotech. And we don't need to since the US has all the cards here as we are the large majority of the end market for drugs. Hopefully WH holds the line on this one.

Introducing the 1,000 Flower Collection 🧬🌹 I’m creating 1,000 genetically designed flowers each crafted with new colors, patterns, and shapes. Here’s how I’m making it happen…  and how you can join me on this journey 🧵(1/7)

To promote the collection, I’ve launched a designer clothing line where synthetic biology meets aesthetics. I will give out 100 free limited edition shirts to the first who retweet and order with their handle in the name! Available here → nickdesnoyer.com  🧵(6/7)

It’s been a tough few weeks. My 10yo daughter was diagnosed with a very rare, aggressive cancer called interdigitating dendritic cell sarcoma (IDCS). I’m reaching out to identify clinicians/patients who have encountered pediatric IDCS, indeterminate dendritic cell histiocytosis or other (non-LCH) histiocytic sarcomas cases. I'm trying to understand non-surgical chemo and targeted therapy options, new pathology markers to better diagnose subtypes/treatments, and any data on progression in pediatric patients. Please feel free to share – I’m trying to cast a wide net due to the rarity of this condition and how little is known. People can contact me directly at my first name (as written in my profile) at octant.bio.

@aaronmring @davidkmyang @SynBio1 Was it this molecule? en.m.wikipedia.org/wiki/NL-201 It's a shame that the failures in drug discovery get so poorly reported and we depend on word of mouth like this to learn about the real reasons for things getting stopped!

This pretty much settles it: we're entering the era of low-cost, on-demand binders for everything Excited to see what people build now that "inject a llama with some junk and bleed it a month later" is no longer the cutting-edge tech nature.com/articles/s4158…

@ATinyGreenCell @SenseoryPlants Not my field, but I had some fun conversations with @vdlorenzo_CNB at synbio events during my PhD and remember hearing several times about pre-2000s work on GMO microbe persistence in soil that is underappreciated. Not sure if he works on anything like that now, but could help?

Anyone in the soil microbe realm of science willing to have a coffee with me regarding persistence of microbial communities in dirt? Full disclosure it would be for my work at @SenseoryPlants. Happy to pay for your time. Just want some steering as to what lit I should dive into.

@ATinyGreenCell @NEBiolabs Happy to see that they fixed it and once again NEB confirms my impression that they're one of the few companies in life sci that really care about their customers! Every contact with sales and support is pleasant and they seem to genuinely want to help

LITERALLY SAVED MY JOB OMFG!!!!😭 Thank you @NEBiolabs!!!!!

Join us for Recursion’s (L)earnings Call today, 8/8 at 6:30am MT / 8:30am ET. Submit questions at bit.ly/3Ah1OQ4 twitter.com/i/broadcasts/1…

🚨🦇🫒🚨 Alerta de espécie nova de morcego frugívoro - um dos menores do mundo (5g) que comem frutas. Vou contar aqui um pouco de como foi a descoberta e descrição dessa espécie nova descrita por dois pesquisadores brasileiros e dois mexicanos. doi.org/10.1093/jmamma… 1/9

@fvguima Até hoje dou risada quando lembro que o alcance dos soldados do Age of Empires 1 ptbr aparecia como CAMPOS DE TREINAMENTO, pq um jêniu traduziu Archery Range como Campo de Treinamento de Arqueiros e meteu o ctrl+f replace all 🤣

2023 e as pessoas da área ainda não entendem que uma localização mal feita pode literalmente impedir o usuário de acessar funções essenciais do produto

Exscientia will start a new #AI drug discovery collaboration with @MerckHealthcare, combining our AI-driven precision design capabilities with Merck’s oncology & I&I expertise, clinical capabilities. ($20M u/f, $674M total to $EXAI); investors.exscientia.ai/press-releases…

@ideasbyjin Sequence generation conditioned on EC numbers by @ferruz_noelia, @lorenzphil09... Not quite natural language, but that's as close as I can remember right now. huggingface.co/AI4PD/ZymCTRL

Hey Twitter! Can anyone remind me of paper(s) that combine natural language (English, GO processes) and protein sequence language models?

@AramVartian @KEMpodcast @FilmReroll GURPS definitely brings back memories... Never got to try the "newer" edition (from like 2005?), but I vividly remember wild tables and rules that made old school D&D armor class and THAC0 seem perfectly intuitive!

@RealSexyCyborg Very much a mixture... I spotted like 3 Brazilian dishes (coxinha, cheese balls and black bean stew), lots of stuff from other Latin American countries but also Goulash which is eastern European! Maybe a hodgepodge like generic "asian" restaurants in the west would look to you?

Hey South American peeps, what should I get?